View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10186_low_32 (Length: 237)
Name: NF10186_low_32
Description: NF10186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10186_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 2413733 - 2413952
Alignment:
| Q |
1 |
tccatgacatttgttaatttttatccttgttagagcacagcaacaacgtgagggaaggtaaatggttcttacattttgtaagtgctaactcatcacatgc |
100 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2413733 |
tccatgacatttgttaattttgatcctggttagagtacaacaacaacgtgagggaaggtaaatggttcttacattttgtaagtgctaactcatcacatgc |
2413832 |
T |
 |
| Q |
101 |
tatttcccttatttacacaacatgctacgtggcatgtctttagaattcaatgttgtctttttctattaaacatcattacgtgcagcttatacaaattgga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2413833 |
tatttcccttatttacacaacatgctacgtggcatgtctttagaattcaatgttgtttttttctattaaacatcattacgtgcagcttatacaaattgga |
2413932 |
T |
 |
| Q |
201 |
agaaccctcaaggagcttga |
220 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
2413933 |
cgaaccctcaaggagcttga |
2413952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University