View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10186_low_33 (Length: 236)
Name: NF10186_low_33
Description: NF10186
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10186_low_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 92; Significance: 8e-45; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 92; E-Value: 8e-45
Query Start/End: Original strand, 126 - 217
Target Start/End: Complemental strand, 45552478 - 45552387
Alignment:
| Q |
126 |
gcttacacccacatacacgcacgcactgagtgaatgagtgagataacttggacgtcaatctttctcagttcttgatgacagatgacagacct |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45552478 |
gcttacacccacatacacgcacgcactgagtgaatgagtgagataacttggacgtcaatctttctcagttcttgatgacagatgacagacct |
45552387 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 15 - 99
Target Start/End: Complemental strand, 45552589 - 45552505
Alignment:
| Q |
15 |
tagggaggaagccccatggtccatgttgagatagatctcacatcatcatcagcatctaggaattgcttggaatggaataaaagtg |
99 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45552589 |
tagggaggaagccccatggtccatgttgagatagatctcacatcatcatcagcatctaggaattgcttggaatggaataaaagtg |
45552505 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University