View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10187_high_30 (Length: 227)
Name: NF10187_high_30
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10187_high_30 |
 |  |
|
| [»] chr7 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 206; Significance: 1e-113; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 206; E-Value: 1e-113
Query Start/End: Original strand, 1 - 227
Target Start/End: Original strand, 36586233 - 36586465
Alignment:
| Q |
1 |
tttgctttcaatttcctttcttagccactctgtccaatccaatgttctgggttcatgagtggatgtacccctttttaccctcttttttgctttcacttgc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36586233 |
tttgctttcaatttcctttcttagccactctgtccaatccaatgttctgggttcatgagtggatgtacccctttttaccctcttttttgctttcacttgc |
36586332 |
T |
 |
| Q |
101 |
tccgtaaatgaaggtgtctttatctcctctatctctttct------ctttcccataccctatcaataaatctttaagcaccaatcaaaacctctcctttt |
194 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36586333 |
tccgtaaatgaaggtgtctttatctcctctatctctttctctttccctttcccataccctatcaataaatctttaagcaccaatcaaaacctctcctttt |
36586432 |
T |
 |
| Q |
195 |
ttattccccttatgagggaaagtggatttaaaa |
227 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
36586433 |
ttattccccttaagagggaaagtggatttaaaa |
36586465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University