View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10187_low_27 (Length: 333)
Name: NF10187_low_27
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10187_low_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 134 - 326
Target Start/End: Original strand, 43520929 - 43521121
Alignment:
| Q |
134 |
tagggtggcgtaggttaagcaaaggcgcaccagccgcacattctagaaatgagttacacgtgtctacagtttcacagccaaaaccctagttcacact-cc |
232 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |
|
|
| T |
43520929 |
tagggtggcgtaggttaagcaaaggcgcaccagccgcacattctagaaatgagttacacgtgtctacagtttcacagccaaaaccctagttcacactccc |
43521028 |
T |
 |
| Q |
233 |
agtactctttataagcacctcgatacccccttttccattgtatcacagttacgattagggtttctagccgcaacttcatgttttccctttgctt |
326 |
Q |
| |
|
||||||||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43521029 |
agtactctttataagcacctcgata-ccccttctccattgtatcacagttacgattagggtttctagccgcaacttcatgttttccctttgctt |
43521121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University