View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10187_low_28 (Length: 332)
Name: NF10187_low_28
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10187_low_28 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 270; Significance: 1e-151; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 19 - 312
Target Start/End: Original strand, 42457316 - 42457609
Alignment:
| Q |
19 |
gatttgattggaaccttcctcgagatgataagagcttggattctattgattggaatttgttttttggaaatgcggcgaacgagatttggaagaagtgtta |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42457316 |
gatttgattggaaccttcctcgagatgataagagcttggattctattgattggaatttgttttttggaaatgcggcgaacgagatttggaagaagtgtta |
42457415 |
T |
|
| Q |
119 |
gttttctcgaatcatatcaacacatctagggacctttatctctaatattaatcatcaaaccatttgtattgctcaatgtttttctgagaatgaaaatctt |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||| |
|
|
| T |
42457416 |
gttttctcgaatcatatcaacacatctagggacctttatctctaatattaatcatcaaaccatttgtattgctcaatgttttcctgagaatgaaaacctt |
42457515 |
T |
|
| Q |
219 |
ttgaaaccacaaacgtctttattggttgattttggatggttaggtatcactttcgtgtcgtatggcaaattacaggctcattgtattcagtttg |
312 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
42457516 |
ttgaaaccacaaacgtctttattggttgattttggatggttaggtatcactttcgcgtcgcatggtgaattacaggctcattgtattcagtttg |
42457609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 252 - 316
Target Start/End: Original strand, 35120609 - 35120673
Alignment:
| Q |
252 |
ggatggttaggtatcactttcgtgtcgtatggcaaattacaggctcattgtattcagtttggtgg |
316 |
Q |
| |
|
|||||| |||||||||||||||||||| | || ||||||| ||||||| ||||||||||||||| |
|
|
| T |
35120609 |
ggatggctaggtatcactttcgtgtcgcaaggtgaattacatgctcattctattcagtttggtgg |
35120673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000007; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 248 - 311
Target Start/End: Original strand, 10398857 - 10398920
Alignment:
| Q |
248 |
ttttggatggttaggtatcactttcgtgtcgtatggcaaattacaggctcattgtattcagttt |
311 |
Q |
| |
|
|||||||||| ||| |||||||||||||||| | || ||||||||||| ||| |||||||||| |
|
|
| T |
10398857 |
ttttggatggctagatatcactttcgtgtcgcagggtgaattacaggcttattctattcagttt |
10398920 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 286 - 319
Target Start/End: Complemental strand, 6831703 - 6831670
Alignment:
| Q |
286 |
aattacaggctcattgtattcagtttggtggcct |
319 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
6831703 |
aattacaggctcattttattcagtttggtggcct |
6831670 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 155 - 228
Target Start/End: Complemental strand, 7318681 - 7318608
Alignment:
| Q |
155 |
tatctctaatattaatcatcaaaccatttgtattgctcaatgtttttctgagaatgaaaatcttttgaaaccac |
228 |
Q |
| |
|
||||||||| |||| ||||||||||| | |||||||||||| | | || |||||| |||||||||||||||| |
|
|
| T |
7318681 |
tatctctaacattagacatcaaaccatctttattgctcaatgatctcctcagaatggtaatcttttgaaaccac |
7318608 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University