View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10187_low_3 (Length: 460)
Name: NF10187_low_3
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10187_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 289; Significance: 1e-162; HSPs: 6)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 14 - 449
Target Start/End: Complemental strand, 27973057 - 27972633
Alignment:
| Q |
14 |
cttcctttgctgttgttcaataataataggatcttggaataagaattgattccaaggtaagatttattctccatcttaatcattattgcagttcccacgt |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
27973057 |
cttcctttgctgttgttcaataataataggatcttggaataagaattgatgccaaggtaagatttattctccatcttaatcattattgcagtccccacgt |
27972958 |
T |
 |
| Q |
114 |
gggaatgggatgggaatgcaagcaaaagaaaataaaactcactgctagaggttgggg------caataaaatttgagatttcaactcttaattattgtac |
207 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27972957 |
gg--------------------caaaagaaaataaaactcactgctagaggttgggggcggggcaataaaatttgagatttcaactcttaattattgtac |
27972878 |
T |
 |
| Q |
208 |
agatgttaactatgaactgaagtatacattttcaatcagggaggacaaaattatcgtggaaaatggaagtgtctttcaaatgtgcataaaacnnnnnnn- |
306 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
27972877 |
agatgttaactatgaactgaagtatacattttcaatcagggaggacaaaattatcgtgcaaaatgaaagtgtctttcaaatgtgcataaaacaaaaaaaa |
27972778 |
T |
 |
| Q |
307 |
-ttgaaagctttgtaatatatct-atttagtgtaattcagaacatgaatccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgg |
404 |
Q |
| |
|
| |||||||||||||||||| | ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27972777 |
atagaaagctttgtaatatattttatttagtgtaattcacaacatgaatccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgg |
27972678 |
T |
 |
| Q |
405 |
gttcaagtcccggcaacggaatccttttttgttagaaattccttt |
449 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27972677 |
gttcaagtcccggcaacggaatccttttttgttagaaattccttt |
27972633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 81; E-Value: 6e-38
Query Start/End: Original strand, 345 - 433
Target Start/End: Complemental strand, 38584173 - 38584085
Alignment:
| Q |
345 |
aacatgaatccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaatccttttt |
433 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
38584173 |
aacatcaatccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaattcttttt |
38584085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 75; E-Value: 2e-34
Query Start/End: Original strand, 352 - 426
Target Start/End: Original strand, 37235943 - 37236017
Alignment:
| Q |
352 |
atccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaat |
426 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37235943 |
atccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaat |
37236017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 73; E-Value: 4e-33
Query Start/End: Original strand, 345 - 425
Target Start/End: Complemental strand, 38843790 - 38843710
Alignment:
| Q |
345 |
aacatgaatccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaa |
425 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
38843790 |
aacatgaatccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa |
38843710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 69; E-Value: 9e-31
Query Start/End: Original strand, 351 - 427
Target Start/End: Complemental strand, 41303697 - 41303621
Alignment:
| Q |
351 |
aatccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaatc |
427 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
41303697 |
aatccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaatc |
41303621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 352 - 426
Target Start/End: Original strand, 52208007 - 52208081
Alignment:
| Q |
352 |
atccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaat |
426 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52208007 |
atccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaat |
52208081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 76; Significance: 6e-35; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 76; E-Value: 6e-35
Query Start/End: Original strand, 351 - 426
Target Start/End: Complemental strand, 9528982 - 9528907
Alignment:
| Q |
351 |
aatccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaat |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9528982 |
aatccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaat |
9528907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 353 - 426
Target Start/End: Original strand, 35911187 - 35911260
Alignment:
| Q |
353 |
tccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaat |
426 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35911187 |
tccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaat |
35911260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 74; E-Value: 9e-34
Query Start/End: Original strand, 352 - 425
Target Start/End: Original strand, 35916268 - 35916341
Alignment:
| Q |
352 |
atccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaa |
425 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35916268 |
atccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaa |
35916341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 66; E-Value: 5e-29
Query Start/End: Original strand, 353 - 426
Target Start/End: Original strand, 20112825 - 20112898
Alignment:
| Q |
353 |
tccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaat |
426 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20112825 |
tccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaat |
20112898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 72; Significance: 1e-32; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 351 - 426
Target Start/End: Original strand, 48926625 - 48926700
Alignment:
| Q |
351 |
aatccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaat |
426 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48926625 |
aatccgttgtagtctagttggttaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaat |
48926700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 351 - 425
Target Start/End: Original strand, 6055065 - 6055139
Alignment:
| Q |
351 |
aatccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaa |
425 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6055065 |
aatccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa |
6055139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 72; Significance: 1e-32; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 72; E-Value: 1e-32
Query Start/End: Original strand, 351 - 434
Target Start/End: Original strand, 30364369 - 30364452
Alignment:
| Q |
351 |
aatccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaatcctttttt |
434 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
30364369 |
aatccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaatcttttttt |
30364452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 351 - 425
Target Start/End: Original strand, 4308723 - 4308797
Alignment:
| Q |
351 |
aatccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaa |
425 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4308723 |
aatccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa |
4308797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 351 - 425
Target Start/End: Original strand, 4312554 - 4312628
Alignment:
| Q |
351 |
aatccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaa |
425 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4312554 |
aatccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaa |
4312628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 351 - 426
Target Start/End: Original strand, 26286775 - 26286850
Alignment:
| Q |
351 |
aatccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaat |
426 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
26286775 |
aatccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaat |
26286850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 68; Significance: 3e-30; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 68; E-Value: 3e-30
Query Start/End: Original strand, 351 - 438
Target Start/End: Original strand, 42321475 - 42321562
Alignment:
| Q |
351 |
aatccgttgtagtctagttggtcaggatactcggctctcacccgagagacccgggttcaagtcccggcaacggaatccttttttgtta |
438 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42321475 |
aatccgttgtagtctagttggtcaggatattcggctctcacccgaaagacccgggttcaagtcccggcaacggaaattttttttgtta |
42321562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University