View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10187_low_38 (Length: 278)
Name: NF10187_low_38
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10187_low_38 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 1e-59; HSPs: 5)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 27099613 - 27099485
Alignment:
| Q |
1 |
atgcacacaaccgtaacaaccattattactgatctagctagtgggttctcttcgcagctcctcctagataggataccaactaaagctaatatgcttaagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27099613 |
atgcacacaaccgtaacaaccattattactgatccagctagtgggttcccttcgcagctcctcctagataggataccaactaaagctaatatgcttaagt |
27099514 |
T |
|
| Q |
101 |
ataggagtattagtgatccgttggtgctc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27099513 |
ataggagtattagtgatccgttggtgctc |
27099485 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 1 - 129
Target Start/End: Original strand, 27178690 - 27178818
Alignment:
| Q |
1 |
atgcacacaaccgtaacaaccattattactgatctagctagtgggttctcttcgcagctcctcctagataggataccaactaaagctaatatgcttaagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27178690 |
atgcacacaaccgtaacaaccattattactgatccagctagtgggttcccttcgcagctcctcctagataggataccaactaaagctaatatgcttaagt |
27178789 |
T |
|
| Q |
101 |
ataggagtattagtgatccgttggtgctc |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27178790 |
ataggagtattagtgatccgttggtgctc |
27178818 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 127 - 245
Target Start/End: Complemental strand, 27099420 - 27099302
Alignment:
| Q |
127 |
ctctaaggtgtggtataggatttttaagtggttaggttggatttcagttttgcctaaggacttagtttgtctttttgaggggtttctagagctagttggg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27099420 |
ctctaaggtgtggtataggatttttaagtggttaggttggatttcaattttgcctaatgacttagtttgtctttttgaggggtttctagagctagttggg |
27099321 |
T |
|
| Q |
227 |
agagataaaactatgcatg |
245 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
27099320 |
agagataaaactatgcatg |
27099302 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 111; E-Value: 4e-56
Query Start/End: Original strand, 127 - 245
Target Start/End: Original strand, 27178883 - 27179001
Alignment:
| Q |
127 |
ctctaaggtgtggtataggatttttaagtggttaggttggatttcagttttgcctaaggacttagtttgtctttttgaggggtttctagagctagttggg |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27178883 |
ctctaaggtgtggtataggatttttaagtggttaggttggatttcaattttgcctaatgacttagtttgtctttttgaggggtttctagagctagttggg |
27178982 |
T |
|
| Q |
227 |
agagataaaactatgcatg |
245 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
27178983 |
agagataaaactatgcatg |
27179001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 133 - 165
Target Start/End: Original strand, 26411173 - 26411205
Alignment:
| Q |
133 |
ggtgtggtataggatttttaagtggttaggttg |
165 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
26411173 |
ggtgtggtataggatttttatgtggttaggttg |
26411205 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University