View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10187_low_43 (Length: 262)
Name: NF10187_low_43
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10187_low_43 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 154; Significance: 9e-82; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 154; E-Value: 9e-82
Query Start/End: Original strand, 19 - 236
Target Start/End: Original strand, 41043464 - 41043684
Alignment:
| Q |
19 |
cttcattccctcttcttttgatggttatcaaaaagtaacaaatttaatttaaannnnnnnn---ggtaaaatatcaaatcctattaattatacttaaaag |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
41043464 |
cttcattccctcttcttttgatggttatcaaaaagtaacaaatttaatttaattttttttttttggtaaaatatcaaatcctattaattatacttaaaag |
41043563 |
T |
 |
| Q |
116 |
aatannnnnnngactgatacttaaatgctcttcaactaatttttctcacatgtgccaggctttgcacatgacaaagaacattaatttttcacattttttc |
215 |
Q |
| |
|
|||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41043564 |
aatatttttttgactgatacttaaatgctcatcaactaatttttctcacatgtgccaggctttgcacatgacaaagaacattaatttttcacattttttc |
41043663 |
T |
 |
| Q |
216 |
ttattccatgtctttccatta |
236 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
41043664 |
ttattccatgtctttccatta |
41043684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University