View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10187_low_50 (Length: 250)
Name: NF10187_low_50
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10187_low_50 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 240
Target Start/End: Complemental strand, 27832345 - 27832105
Alignment:
| Q |
1 |
ccttcaatagttaggatagactgaatttgatttgttgtaaaactaagtttattagaattgaatctatgagaatcgctaaaagtttatagcatctaaaccg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27832345 |
ccttcaatagttaggatagactgaatttgatttgttgtaaaactaagtttattagaattgaatctatgagaatcgctaaaagtttatagcatctaaaccg |
27832246 |
T |
|
| Q |
101 |
aagtaaaataaacatatgcataaaaaaccttcaaaacttcatgt-ttttcagttcttgtctatattgattccactaatcaccatattatgttgaatgaat |
199 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27832245 |
aagtaaaataaacctatgcataaaaaaccttcaaaacttcatgttttttcagtttttgtctatattgattccactaatcaccatattatgttgaatgaat |
27832146 |
T |
|
| Q |
200 |
catcagttccaaattgttttaaaaactttctagtgtctgtg |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
27832145 |
catcagttccaaattgttttaaaaactttctagtgtgtgtg |
27832105 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University