View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10187_low_55 (Length: 245)
Name: NF10187_low_55
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10187_low_55 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 54868102 - 54867894
Alignment:
| Q |
1 |
aatgaattaaacaaagcacccccaaattaagccacaaaacagaacaatatatggatcgatgataatcaatgagaagtagtctgatccttgtgatcatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| ||| |||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54868102 |
aatgaattaaacaaagcacccccaaa----gccacaaaacagaagaat----ggatcgatgataatcaatgagaagtagtctcatccttgtgatcatgat |
54868011 |
T |
 |
| Q |
101 |
catgatcatgatcagtagcagtcttagggtgataaccaggaatcttctctttgatcttttccaatatacctttcttc---tctccttgatcatgac---t |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| | |
|
|
| T |
54868010 |
catgatcatgatcagtagcagtcttagggtgataaccaggaatcttctctttgatcttttccaatatacctttcttctgatctccttgatcatgactagt |
54867911 |
T |
 |
| Q |
195 |
agttgttgtctcagcag |
211 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
54867910 |
agttgttgtctcagcag |
54867894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University