View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10187_low_58 (Length: 241)
Name: NF10187_low_58
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10187_low_58 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 48894330 - 48894553
Alignment:
| Q |
1 |
attagcaacttccttcattaccatgttctgatttggatttcctttcttgccactatttccattgccggcattgttcatcttagctataatacctttcttc |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48894330 |
attagcaccttccttcattaccatgttctgatttggatttcctttcttgccactatttccattgccagcattgttcatcttagctataatacctttcttc |
48894429 |
T |
|
| Q |
101 |
acattgtttgcatcattcgcttgctttagcatctgaagatgattggttctctccctgatgaaccgcatctcttcatcctcctcctcttcgtcctcgtcat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48894430 |
acattgtttgcatcattcgcttgctttagcatctgaagatgattagttctctccctgatgaaccgcatctcttcatcctcctcctcttcgtcctcgtcat |
48894529 |
T |
|
| Q |
201 |
attcgtagtattcatcatcctctt |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
48894530 |
attcgtagtattcatcatcctctt |
48894553 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University