View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10187_low_63 (Length: 240)
Name: NF10187_low_63
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10187_low_63 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 163; Significance: 3e-87; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 9 - 240
Target Start/End: Complemental strand, 7828556 - 7828325
Alignment:
| Q |
9 |
acatcatcaaagaataggtgcatgtcatgcatgattattagtaaaacgnnnnnnnnncaaagctttatctaagtacaatgcataattttttgtcgtctaa |
108 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||| |||||||| ||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
7828556 |
acatcattcaagaataggtgcatgtcatgcatgattatt-gtaaaacgaaaaaaaa-caaagctctatctaagtacaatgcataattttttgtcgtctag |
7828459 |
T |
 |
| Q |
109 |
ttcttgtctgattgtggtgtggtgaatcatacagaatgttgattatgtggtgattagtgattacttcaaaacaaattatgctatttgatccttca--ttg |
206 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| ||| |
|
|
| T |
7828458 |
ttcttgtctgattgtggtgtggtgaatcatacagaatgttgattatgtggtgattagtgattaattcaaaacaaattatgctatttgatccttcattttg |
7828359 |
T |
 |
| Q |
207 |
tcttttttaattgtggtaagactaagaaaggttc |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
7828358 |
tcttttttaattgtggtaagactaagaaaggttc |
7828325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University