View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10187_low_65 (Length: 239)
Name: NF10187_low_65
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10187_low_65 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 216; Significance: 1e-119; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 6840269 - 6840046
Alignment:
| Q |
1 |
attgagaagaagagatatttaccagggagtgagttatgagaatggatataacgagaggttacttatgctgggtttaatgaaagtatttaatggaagtgtc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6840269 |
attgagaagaagagatatttaccagggagtgagttatgagaatggatataacgagaggttacttatgctgggtttaatgaaagtatttaatggaagtgtc |
6840170 |
T |
|
| Q |
101 |
acgttggtggtgtgttttttgagtcccattatataggagagcagcattgggttcattaccttagtgctatggtttttggttttaagtcgtgatcaaggcc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
6840169 |
acgttggtggtgtgttttttgagtcccattatataggagagcagcattgggttcattcccttagtgctatgatttttggttttaagtcgtgatcaaggcc |
6840070 |
T |
|
| Q |
201 |
cgcatgtccccatgcatgaattct |
224 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6840069 |
cgcatgtccccatgcatgaattct |
6840046 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 18 - 86
Target Start/End: Complemental strand, 6834914 - 6834843
Alignment:
| Q |
18 |
tttaccagggagtgagttatgaga---atggatataacgagaggttacttatgctgggtttaatgaaagtat |
86 |
Q |
| |
|
||||||||||||||||||||| |||||| | |||||||||||||| |||||||||||||||| |||| |
|
|
| T |
6834914 |
tttaccagggagtgagttatggtggtgatggatttcacgagaggttacttttgctgggtttaatgaaggtat |
6834843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University