View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10187_low_70 (Length: 238)
Name: NF10187_low_70
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10187_low_70 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 3629118 - 3628902
Alignment:
| Q |
1 |
ataacggagacagttattgttatttcatcgatgacgtggcaaaatgccttaacgaaggtagttttgatgtcaatacgaatacatattcgatctcaacgag |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3629118 |
ataacggagacagttattattatttcatcgatgacgtggcaaaatgccttaacgaaggtagttttgatgtcaatacgaatacatattcgatctcaacgag |
3629019 |
T |
|
| Q |
101 |
aaagaagagnnnnnnntcgaaatcgaattcgaatgagaaagaggaaatgttgatgttagtgttacctaatttgaagctgagagttgttcaggaagcgtta |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
3629018 |
aaagaagagaaaa------aaatcgaattcgaatgagaaagaggaaatgttgacgttggtgttacctaatttgaagctgagagttgttcaggaagcttta |
3628925 |
T |
|
| Q |
201 |
aggattgttttagaagtgatttt |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3628924 |
aggattgttttagaagtgatttt |
3628902 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University