View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10187_low_72 (Length: 235)

Name: NF10187_low_72
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10187_low_72
NF10187_low_72
[»] chr1 (1 HSPs)
chr1 (114-223)||(29160683-29160791)


Alignment Details
Target: chr1 (Bit Score: 77; Significance: 7e-36; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 77; E-Value: 7e-36
Query Start/End: Original strand, 114 - 223
Target Start/End: Complemental strand, 29160791 - 29160683
Alignment:
114 ctacaattgaattgcagcatctttgtggattagttattttgatttgatttctaannnnnnnnggttacggatcagtgattttgtacgataatttaacatc 213  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||        ||||| ||||||||||||||||||||||||||||||||    
29160791 ctacaattgaattgcagcatctttgtggattagttattttgatttgatttctaa-tttttttggttaaggatcagtgattttgtacgataatttaacatc 29160693  T
214 aattcattat 223  Q
    ||||||||||    
29160692 aattcattat 29160683  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University