View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10187_low_73 (Length: 233)
Name: NF10187_low_73
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10187_low_73 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 53 - 215
Target Start/End: Complemental strand, 10526738 - 10526569
Alignment:
| Q |
53 |
catatcagttctctgatcttggctgctaaaagtccgttcttctataaggcagaccaagatctctatatcttta-------cattgtatagttttgccaaa |
145 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |||||||||||||||| |||||||| |||||||||||||| |||||||||||| ||||||| |
|
|
| T |
10526738 |
catatcagttctccgatcttggctgctaaaagcccgttcttctataaggtagaccaagttctctatatctttatattgtacattgtatagttctgccaaa |
10526639 |
T |
|
| Q |
146 |
aatttgttttcttagcagtgtttatttacctgttgcagcttttttccaatgggatgagggaatcagaact |
215 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
10526638 |
aatatgttttcttagcagtgtttatttaccttttgcagcttttttcgaatgggatgagggaatcggaact |
10526569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 3 - 54
Target Start/End: Complemental strand, 10526811 - 10526760
Alignment:
| Q |
3 |
tgtaaaagacaatgatgaacccaacctgggcatggattactctgaagctgca |
54 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
10526811 |
tgtaaacgacaatgatgaacccaacctgggcatggattactctgaacctgca |
10526760 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 923887 - 923940
Alignment:
| Q |
1 |
gttgtaaaagacaatgatgaacccaacctgggcatggattactctgaagctgca |
54 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
923887 |
gttgtaaaagacaatgatgaacctaacctgggcatggattgctctgaagctgca |
923940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University