View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10187_low_74 (Length: 232)
Name: NF10187_low_74
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10187_low_74 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 20 - 219
Target Start/End: Original strand, 30618175 - 30618374
Alignment:
| Q |
20 |
cttgttcagttctatggctaatatcaacattcacatgattcaattcaacttgctccatgtcttttaaacgctttgcagcaccaccaattggtaatgtgct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30618175 |
cttgttcagttctatggctaatatcaacattcacatgattcaattcaacttgctccatgtcttttaaacgctttgcagcaccaccaattggtaatgtgct |
30618274 |
T |
|
| Q |
120 |
gctctcaagtatggttttgacatcatatctgctcatgtcaaagtttgtaactgcactcagtcctctgaattttattgctgccacatcatatgcctatgct |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
30618275 |
gctctcaagtatggttttgacatcatatctgctcatgtcaaagtttgtaactgcactcagtcctctgaattttattgctgccacatcatatgcctctgct |
30618374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 32 - 104
Target Start/End: Original strand, 54689401 - 54689473
Alignment:
| Q |
32 |
tatggctaatatcaacattcacatgattcaattcaacttgctccatgtcttttaaacgctttgcagcaccacc |
104 |
Q |
| |
|
|||||| |||||||||||||||| ||||| |||||| |||||| ||||||||||| ||||| || ||||||| |
|
|
| T |
54689401 |
tatggccaatatcaacattcacacgattcgattcaatttgctctatgtcttttaactgctttacaacaccacc |
54689473 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 200
Target Start/End: Original strand, 24561661 - 24561709
Alignment:
| Q |
152 |
tcatgtcaaagtttgtaactgcactcagtcctctgaattttattgctgc |
200 |
Q |
| |
|
|||||||||||||||| || || | ||||||||||||||||||||||| |
|
|
| T |
24561661 |
tcatgtcaaagtttgttacagcgttgagtcctctgaattttattgctgc |
24561709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University