View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10187_low_75 (Length: 231)

Name: NF10187_low_75
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10187_low_75
NF10187_low_75
[»] chr2 (2 HSPs)
chr2 (151-217)||(19247953-19248019)
chr2 (30-96)||(19248069-19248135)


Alignment Details
Target: chr2 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 151 - 217
Target Start/End: Complemental strand, 19248019 - 19247953
Alignment:
151 tgaattaccaacctgcatttcatgtgattgcatccttcagacttttcaataaactgtttacaaagtg 217  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
19248019 tgaattaccaacctgcatttcatgtgattgcatccttcagacttttcaataaactgtttacaaagtg 19247953  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 30 - 96
Target Start/End: Complemental strand, 19248135 - 19248069
Alignment:
30 aaatgaaaccttaaataagatttattgattaatcaagaattcaaagacatacacattcaatgatttt 96  Q
    |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||    
19248135 aaatgaaaccttaaataagattaattgattaatcaagaattcaaagacatacacattcaatgatttt 19248069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University