View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10187_low_85 (Length: 222)
Name: NF10187_low_85
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10187_low_85 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 150; Significance: 2e-79; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 150; E-Value: 2e-79
Query Start/End: Original strand, 17 - 207
Target Start/End: Original strand, 21018838 - 21019034
Alignment:
| Q |
17 |
agacttgtgttttttgtggaaggttggaggaaacggcgttgc------acctcttcttaagttgcgaggtggttacgaggttgtggcaaaaggttatgca |
110 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
21018838 |
agacttgtgttttttttggaaggttggaggaaacggcgttgcacttgcacctcttcttacattgcaaggtggttacgaggttgtggcaaaaggttatgca |
21018937 |
T |
 |
| Q |
111 |
gtggcttcaatttaactttataacaccgcataatctttgggctcattttctgtgttggtcaaacacggcgtcaactaagaagcttagacatggcttc |
207 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
21018938 |
gtggcttcaatttaattttataacaccgcataatctttgggctcattttctgtgttggtcaaacgcggcgtcaactaagaagcttagacatggcttc |
21019034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University