View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10187_low_87 (Length: 220)
Name: NF10187_low_87
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10187_low_87 |
 |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 191; Significance: 1e-104; HSPs: 10)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 30264448 - 30264258
Alignment:
| Q |
18 |
caaacttcatcatgcacttggtgatggttactctctcatgggtgctcttctttcttgtcttcatagagctgatgatccttctcttcctttgtcttttcct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30264448 |
caaacttcatcatgcacttggtgatggttactctctcatgggtgctcttctttcttgtcttcatagagctgatgatccttctcttcctttgtcttttcct |
30264349 |
T |
 |
| Q |
118 |
aaccgcaagtcatcacaattgttaactcccaagagaggctttttcaagtggttcccttcaaccatattctcccttttcaattcaatctctg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30264348 |
aaccgcaagtcatcacaattgttaactcccaagagaggctttttcaagtggttcccttcaaccatattctcccttttcaattcaatctctg |
30264258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 18 - 208
Target Start/End: Original strand, 30287740 - 30287930
Alignment:
| Q |
18 |
caaacttcatcatgcacttggtgatggttactctctcatgggtgctcttctttcttgtcttcatagagctgatgatccttctcttcctttgtcttttcct |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30287740 |
caaacttcatcatgcacttggtgatggttactctctcatgggtgctcttctttcttgtcttcatagagctgatgatccttctcttcctttgtcttttcct |
30287839 |
T |
 |
| Q |
118 |
aaccgcaagtcatcacaattgttaactcccaagagaggctttttcaagtggttcccttcaaccatattctcccttttcaattcaatctctg |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30287840 |
aaccgcaagtcatcacaattgttaactcccaagagaggctttttcaagtggttcccttcaaccatattctcccttttcaattcaatctctg |
30287930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 30271342 - 30271160
Alignment:
| Q |
18 |
caaacttcatcatgcacttggtgatggttactctctcatgggtgctcttctttcttgtcttcatagagctgatgatccttctcttcctttgtcttttcct |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30271342 |
caaacttcaccatgcacttggtgatggttactctctcatgggtgctcttctttcttgtctacaaagagctgatgacccttctcttcctttgtcttttcct |
30271243 |
T |
 |
| Q |
118 |
aaccgcaagtcatcacaattgttaactcccaagagaggctttttcaagtggttcccttcaaccatattctcccttttcaattc |
200 |
Q |
| |
|
||||| |||||||||||||| ||||||||| ||| |||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
30271242 |
tcacgcaaaccatcacaattgttatctcccaagaaaggttttttcaagtggtttccttcaaccatattctcctttttcaattc |
30271160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 18 - 200
Target Start/End: Original strand, 30280847 - 30281029
Alignment:
| Q |
18 |
caaacttcatcatgcacttggtgatggttactctctcatgggtgctcttctttcttgtcttcatagagctgatgatccttctcttcctttgtcttttcct |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||| |||||||||||||||||||||||| |
|
|
| T |
30280847 |
caaacttcaccatgcacttggtgatggttactctctcatgggtgctcttctttcttgtctacaaagagctgatgacccttctcttcctttgtcttttcct |
30280946 |
T |
 |
| Q |
118 |
aaccgcaagtcatcacaattgttaactcccaagagaggctttttcaagtggttcccttcaaccatattctcccttttcaattc |
200 |
Q |
| |
|
||||| |||||||||||||| ||||||||| ||| |||||||||||||| |||||||||||||||||| |||||||||| |
|
|
| T |
30280947 |
tcacgcaaaccatcacaattgttatctcccaagaaaggttttttcaagtggtttccttcaaccatattctcctttttcaattc |
30281029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 18 - 200
Target Start/End: Complemental strand, 30304409 - 30304227
Alignment:
| Q |
18 |
caaacttcatcatgcacttggtgatggttactctctcatgggtgctcttctttcttgtcttcatagagctgatgatccttctcttcctttgtcttttcct |
117 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| || |||| |||||| |||||||||||||||||||||||| |
|
|
| T |
30304409 |
caaacttcaccatgcacttggtgatggttactctctcatgggtgctcttctttcttgtctacaaagagttgatgacccttctcttcctttgtcttttcct |
30304310 |
T |
 |
| Q |
118 |
aaccgcaagtcatcacaattgttaactcccaagagaggctttttcaagtggttcccttcaaccatattctcccttttcaattc |
200 |
Q |
| |
|
||||| |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||| || |||||||||| |
|
|
| T |
30304309 |
tcacgcaaaccatcacaattgttatctcccaagaaaggctttttcaagtggttcccttcaaccatattcccctttttcaattc |
30304227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 18 - 117
Target Start/End: Complemental strand, 30032400 - 30032301
Alignment:
| Q |
18 |
caaacttcatcatgcacttggtgatggttactctctcatgggtgctcttctttcttgtcttcatagagctgatgatccttctcttcctttgtcttttcct |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||| |
|
|
| T |
30032400 |
caaacttcatcatgcacttggtgacggttactctctcatgggtgctcttctttcttgtcttcaaagagctgatgatccttctcttcctttatcttttcct |
30032301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 18 - 117
Target Start/End: Complemental strand, 30048646 - 30048547
Alignment:
| Q |
18 |
caaacttcatcatgcacttggtgatggttactctctcatgggtgctcttctttcttgtcttcatagagctgatgatccttctcttcctttgtcttttcct |
117 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||| |
|
|
| T |
30048646 |
caaacttcatcatggacttggtgatggttactctctcatgggtgctcttctttcttgtcttcaaagagctgatgatccttctcttcctctatcttttcct |
30048547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 18 - 117
Target Start/End: Complemental strand, 30062987 - 30062888
Alignment:
| Q |
18 |
caaacttcatcatgcacttggtgatggttactctctcatgggtgctcttctttcttgtcttcatagagctgatgatccttctcttcctttgtcttttcct |
117 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||| |
|
|
| T |
30062987 |
caaacttcatcatggacttggtgatggttactctctcatgggtgctcttctttcttgtcttcaaagagctgatgatccttctcttcctctatcttttcct |
30062888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 18 - 117
Target Start/End: Original strand, 30220279 - 30220378
Alignment:
| Q |
18 |
caaacttcatcatgcacttggtgatggttactctctcatgggtgctcttctttcttgtcttcatagagctgatgatccttctcttcctttgtcttttcct |
117 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||| |
|
|
| T |
30220279 |
caaacttcaccatgcacttggtgatggttactctctcatgggtgctcttctttcttgtcttcaaagagctgatgatccttctcttcctctatcttttcct |
30220378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 18 - 117
Target Start/End: Complemental strand, 30228785 - 30228686
Alignment:
| Q |
18 |
caaacttcatcatgcacttggtgatggttactctctcatgggtgctcttctttcttgtcttcatagagctgatgatccttctcttcctttgtcttttcct |
117 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||| | ||||||||| |
|
|
| T |
30228785 |
caaacttaatcatgcacttggtgatggttactctctcatgagtgctcttctttcttgtcttcaaagagctgatgatccttctcttcctctatcttttcct |
30228686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 60; Significance: 9e-26; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 9e-26
Query Start/End: Original strand, 18 - 117
Target Start/End: Original strand, 2311389 - 2311488
Alignment:
| Q |
18 |
caaacttcatcatgcacttggtgatggttactctctcatgggtgctcttctttcttgtcttcatagagctgatgatccttctcttcctttgtcttttcct |
117 |
Q |
| |
|
||||||||| ||||||||||| |||||||| ||||| |||||||| |||||||||||||| || | ||||||||||| ||||||||||||||||||||| |
|
|
| T |
2311389 |
caaacttcaccatgcacttggagatggttattctctaatgggtgcacttctttcttgtctacaacgtgctgatgatccatctcttcctttgtcttttcct |
2311488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 116
Target Start/End: Complemental strand, 29483291 - 29483193
Alignment:
| Q |
18 |
caaacttcatcatgcacttggtgatggttactctctcatgggtgctcttctttcttgtcttcatagagctgatgatccttctcttcctttgtcttttcc |
116 |
Q |
| |
|
|||| |||| |||||| |||| ||||| ||| ||||||||||| ||||||| | ||||| |||||||||||||||||||| | |||||| ||||| |
|
|
| T |
29483291 |
caaatttcaccatgcaattggagatggctacaatctcatgggtgtcattctttcgagccttcaaagagctgatgatccttctctccgtttgtcctttcc |
29483193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 47; Significance: 5e-18; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 18 - 104
Target Start/End: Complemental strand, 79620 - 79534
Alignment:
| Q |
18 |
caaacttcatcatgcacttggtgatggttactctctcatgggtgctcttctttcttgtcttcatagagctgatgatccttctcttcc |
104 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |||||||| |||||||| ||| | | ||||||||| | ||||||||||| |
|
|
| T |
79620 |
caaacttcatcatgcacttggagatggttactctctaatgggtgcacttctttcatgtttagaaagagctgataacccttctcttcc |
79534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 18 - 68
Target Start/End: Complemental strand, 72556 - 72506
Alignment:
| Q |
18 |
caaacttcatcatgcacttggtgatggttactctctcatgggtgctcttct |
68 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| ||||| |||||||| |
|
|
| T |
72556 |
caaacttcatcatgcacttggagatggttactctctaatgggagctcttct |
72506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University