View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10187_low_89 (Length: 219)
Name: NF10187_low_89
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10187_low_89 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 115; Significance: 1e-58; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 73 - 187
Target Start/End: Original strand, 36537410 - 36537524
Alignment:
| Q |
73 |
tagtagagttttatgtattgaatttgagtagttttggtagtcttggaacgtgagagtggaacggttagttaacggaatgagctcattggtggaagtggaa |
172 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36537410 |
tagtagagttttatgtattgaatttgagtagttttggtagtcttggaacgtgagagtggaacggttagttaacggaatgagctcattggtggaagtggaa |
36537509 |
T |
|
| Q |
173 |
cggtttctaagaaat |
187 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
36537510 |
cggtttctaagaaat |
36537524 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 1 - 78
Target Start/End: Original strand, 36537264 - 36537341
Alignment:
| Q |
1 |
cttttttgatcaatgacttgaaacggctttgaaatgacttcatggatgattcgttttcttgtgtcaatgaggtagtag |
78 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36537264 |
cttttttgatcaatgacttgaaacggctttgaaatgacttcatggatgattcgttttcttgtgtcaatgaggtagtag |
36537341 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University