View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10187_low_90 (Length: 216)
Name: NF10187_low_90
Description: NF10187
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10187_low_90 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 161; Significance: 5e-86; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 3 - 200
Target Start/End: Original strand, 12607650 - 12607839
Alignment:
| Q |
3 |
aatctttatcaagaacctacataaaactcaagatgcgttttcccatcccaaccatatttttcttttatattcaaaattctaaaattgtcaataagagtcc |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12607650 |
aatctttatcaagaacctacataaaactcaagatgcgttttcccatcccagccatatttttcttttatattcaaaattctaaaattgtcaataagagtcc |
12607749 |
T |
|
| Q |
103 |
aaaatcaaacttatgacaacttacttgaagaggttcagatatgttacccctataagcaatctattaatcaattgttggcatataatattagttctaat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12607750 |
aaaatcaaacttatgacaacttacttgaagaggttcagatatgttacc--------caatctattaatctattgttggcatataatattagttctaat |
12607839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University