View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10188_high_8 (Length: 250)
Name: NF10188_high_8
Description: NF10188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10188_high_8 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 50 - 240
Target Start/End: Original strand, 41331127 - 41331325
Alignment:
| Q |
50 |
gaaaatgaagtttggtccgtgaagagtatcgacaatggcatcgatcatgggagggagtgtcttcgtgtcttgtttagatgcttacaaatattcacgggag |
149 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41331127 |
gaaaatgaagtttggtccgtgaagagtatcgacaatggcatcgatcatgggagggagtgtcttcgtgtcttgtttagatgcttacaaatattcacgggag |
41331226 |
T |
|
| Q |
150 |
aagagcaaatagtattttagtag--------gtcacatatacatgttcaaacaaaattccgtgaccaatgtggacccatccaaagagtgctattggcca |
240 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
41331227 |
aagagcaaatagtattttagtaggtcacaatgtcacatatacatgttgaaacaaaattccgtgaccaatgtggacccatccaaagagtgctcttggcca |
41331325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 25 - 57
Target Start/End: Original strand, 41331072 - 41331104
Alignment:
| Q |
25 |
agaatacacaggtctattttacatggaaaatga |
57 |
Q |
| |
|
||||| ||||||||||||||||||||||||||| |
|
|
| T |
41331072 |
agaatgcacaggtctattttacatggaaaatga |
41331104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University