View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10188_low_18 (Length: 275)
Name: NF10188_low_18
Description: NF10188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10188_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 250; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 16 - 265
Target Start/End: Original strand, 29618492 - 29618741
Alignment:
| Q |
16 |
catgaaacaggtgactttcaatggaagaaacagaagagagggaggaaaatgtagaaccagaaccaaacaacccggaaaatgagaatgaagaagaatgcaa |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29618492 |
catgaaacaggtgactttcaatggaagaaacagaagagagggaggaaaatgtagaaccagaaccaaacaacccggaaaatgagaatgaagaagaatgcaa |
29618591 |
T |
|
| Q |
116 |
cgctgtggtggtggtggaggagatccaaggactcatcgaatcggtggttcaattcggtgaatacagaagaacacaaaggaaagaatcacacaacctcgct |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29618592 |
cgctgtggtggtggtggaggagatccaaggactcatcgaatcggtggttcaattcggtgaatacagaagaacacaaaggaaagaatcacacaacctcgct |
29618691 |
T |
|
| Q |
216 |
cgtcgtttcaaacacatgttgcctcttatggaagaccttcgtgacctttg |
265 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29618692 |
cgtcgtttcaaacacatgttgcctcttatggaagaccttcgtgacctttg |
29618741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University