View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10188_low_32 (Length: 216)
Name: NF10188_low_32
Description: NF10188
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10188_low_32 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 177; Significance: 1e-95; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 177; E-Value: 1e-95
Query Start/End: Original strand, 13 - 197
Target Start/End: Complemental strand, 43091841 - 43091657
Alignment:
| Q |
13 |
agcagagagtaaagccaagaagaagaaggcggcgccggcggcggatgaggatgcagactcaccggcagatggaccagatgcagatgcagattctgatgat |
112 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091841 |
agcaaagagtaaagccaagaagaagaaggcggcgccggcggcggatgaggatgcagactcaccggcagatggaccagatgcagatgcagattctgatgat |
43091742 |
T |
|
| Q |
113 |
cagaaagctgctgatgatgaaaatggagttaatggattaaatcaagggttgagattcattatggtatttttcagtttgtttattg |
197 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43091741 |
cagaaagctgctgataatgaaaatggagttaatggattaaatcaagggttgagattcattatggtatttttcagtttgtttattg |
43091657 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University