View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10189_high_17 (Length: 247)
Name: NF10189_high_17
Description: NF10189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10189_high_17 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 16 - 228
Target Start/End: Original strand, 25561659 - 25561871
Alignment:
| Q |
16 |
aagaagaagcaaaaacctccnnnnnnnntggaagaaaacaaagaatcttcaaaaggggttatcgaaaaccaacaacaagagacaaaaaacaaggttttag |
115 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25561659 |
aagaagaagcaaaaacctccaaaaaaaatggaagaaaacaaagaatcttcaaaaggggttatcgaaaaccaacaacaagagacaaaaaacaaggttttag |
25561758 |
T |
 |
| Q |
116 |
catcattggttgaagctttttcattgtcttcaatggaagaagcagttatggcttatgatgttgcaaagggtgatgtaaacaaagcttctgagatcttaag |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25561759 |
catcattggttgaagctttttcattgtcttcaatggaagaagcagttatggcttatgatgttgcaaagggtgatgtaaacaaagcttctgagatcttaag |
25561858 |
T |
 |
| Q |
216 |
cagaggtttgggt |
228 |
Q |
| |
|
||||||||||||| |
|
|
| T |
25561859 |
cagaggtttgggt |
25561871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University