View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10189_high_24 (Length: 213)
Name: NF10189_high_24
Description: NF10189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10189_high_24 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 16 - 198
Target Start/End: Complemental strand, 8058924 - 8058742
Alignment:
| Q |
16 |
catctcacagtcacaaattactcaaaagtaagaaacaaaatccaagacttctaaacaacaaattgaaattcttcacaatgtaattagaaagagtaatgta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8058924 |
catctcacagtcacaaattactcaaaagtaagaaacaaaatccaagacttctaaacaacaaattgaaattcttcacaatgtaattagaaagagtaatgta |
8058825 |
T |
 |
| Q |
116 |
ggaaaaaataaaataaaggggttcttaatcgattgatcgaacttcggtgttagctgacattttctctaaatctaacggtctct |
198 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8058824 |
ggaaaaaataaaataaaggggttcttaatcgattgatcgaacttcggtgttagctgacattttctctaaatctaacggtctct |
8058742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University