View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10189_low_14 (Length: 282)
Name: NF10189_low_14
Description: NF10189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10189_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 1 - 272
Target Start/End: Original strand, 31831193 - 31831464
Alignment:
| Q |
1 |
tactaaactactaatctttactacaatacttaaaatgtgtagtagtatttctaaacttgatactggatttgaccttgctctagaggatttgagcaccagt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
31831193 |
tactaaactactaatctttactacaatacttaaaatgtgtagtagtatttctaaacttgaaactggatttgaccatgctctagaggatttgagcaccagt |
31831292 |
T |
|
| Q |
101 |
gtaggtttgaccaaaagaccatccagctggagcaacattattggaaacaacagtacgaccatcactagttgtaaccttaaaagacaaactttgaccattg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31831293 |
gtaggtttgaccaaaagaccatccagctggagcaacattattggaaacaacagtacgaccatcactagttgtaaccttaaaagacaaactttgaccattg |
31831392 |
T |
|
| Q |
201 |
agataattgttgctctgccagttttgtccccagtttcttgacatagatatccaaccagtttttgagcctttg |
272 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31831393 |
agataattgttgctctgccagttttgtccccagtttcttgacatagatatccaaccagtttttgaccctttg |
31831464 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 66; Significance: 3e-29; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 79 - 244
Target Start/End: Original strand, 18300386 - 18300551
Alignment:
| Q |
79 |
tctagaggatttgagcaccagtgtaggtttgaccaaaagaccatccagctggagcaacattattggaaacaacagtacgaccatcactagttgtaacctt |
178 |
Q |
| |
|
||||| ||| ||||||||||||||||||||||||||| ||||| |||| |||||||||||| ||||||| || || |||||||| ||||||||||| |
|
|
| T |
18300386 |
tctagcggaattgagcaccagtgtaggtttgaccaaaggaccaaccagatggagcaacattgttggaaatgactgttttgccatcacttgttgtaacctt |
18300485 |
T |
|
| Q |
179 |
aaaagacaaactttgaccattgagataattgttgctctgccagttttgtccccagtttcttgacat |
244 |
Q |
| |
|
||||||||| ||| ||||| || ||||||||||| ||||| ||||| ||||| ||||| ||||| |
|
|
| T |
18300486 |
gaaagacaaagcttggccattaaggtaattgttgctttgccaattttgaccccaatttctagacat |
18300551 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 30; Significance: 0.0000001; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 246
Target Start/End: Complemental strand, 42966804 - 42966747
Alignment:
| Q |
189 |
ctttgaccattgagataattgttgctctgccagttttgtccccagtttcttgacatag |
246 |
Q |
| |
|
||||||||||||||||| || ||||| |||||||| || |||||||| || ||||||| |
|
|
| T |
42966804 |
ctttgaccattgagatagttattgctttgccagttctgcccccagttcctagacatag |
42966747 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 246
Target Start/End: Complemental strand, 42975226 - 42975169
Alignment:
| Q |
189 |
ctttgaccattgagataattgttgctctgccagttttgtccccagtttcttgacatag |
246 |
Q |
| |
|
||||||||||||||||| || ||||| |||||||| || |||||||| || ||||||| |
|
|
| T |
42975226 |
ctttgaccattgagatagttattgctttgccagttctgcccccagttcctagacatag |
42975169 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University