View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10189_low_15 (Length: 282)
Name: NF10189_low_15
Description: NF10189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10189_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 108 - 271
Target Start/End: Complemental strand, 41785277 - 41785115
Alignment:
| Q |
108 |
atatttctaaattcaatatatcgatcctccaatttaaatgtttattttattcttgtatattttgaggctatatttttgataatataacaattgaaatgtt |
207 |
Q |
| |
|
|||| |||||||| ||||||| | ||||||||||| ||||||||||||| |||||| |||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
41785277 |
atatctctaaatttaatatattggtcctccaatttgaatgtttattttactcttgtgtattttgaggttatatttt-gataatataacaattgagatgtt |
41785179 |
T |
|
| Q |
208 |
tatgtgacaacttaatcgatcacatgacatatttagatgaattttcacttaacttaactttcat |
271 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
41785178 |
tatgtgacaacttagtcgatcacatgacatatttagatgaatttttacttaacttagctttcat |
41785115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 90; E-Value: 2e-43
Query Start/End: Original strand, 1 - 118
Target Start/End: Complemental strand, 41785456 - 41785339
Alignment:
| Q |
1 |
agtacaaaggcaagctaaataggnnnnnnnnaaggaagaagctagctagataggttaaacgtggatgattgattagtgaaccttaatgaagcataatact |
100 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41785456 |
agtacaaaggcaagctaaataggttttttttaaggaagaagctagctagataggttaaatgtggatgattgattagtgaaccttaatgaagcataatact |
41785357 |
T |
|
| Q |
101 |
attaagaatatttctaaa |
118 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
41785356 |
attaagaatatttctaaa |
41785339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University