View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10189_low_18 (Length: 260)
Name: NF10189_low_18
Description: NF10189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10189_low_18 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 239; Significance: 1e-132; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 239; E-Value: 1e-132
Query Start/End: Original strand, 1 - 251
Target Start/End: Complemental strand, 5573263 - 5573013
Alignment:
| Q |
1 |
atactatagtactccccacttaggctatttgcgggttcaaaaacagcaacagtgcctagtgacaatgcctgcttaaatgaatattattacgccgttaatt |
100 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5573263 |
atactatagtactccccacttaagctatttgcgggttcaaaaacaccaacagtgcctagtgacaatgcctgcttaaatgaatattattacgccgttaatt |
5573164 |
T |
|
| Q |
101 |
ttaaattaatcaattatgtatgtattgttagatataatatctttttgagctggaaagccatgcctggctgcagtgcagacactgaataaccaattaccat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5573163 |
ttaaattaatcaattatgtatgtattgttagatataatatctttttgagctggaaagccatgcctggctgcagtgcagacactgaataaccaattaccat |
5573064 |
T |
|
| Q |
201 |
tactgattttttccacgttatgggagtaattgagcaatttgtgctcccctc |
251 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5573063 |
tactgattttttccacgttatgggagtagttgagcaatttgtgctcccctc |
5573013 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University