View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10189_low_19 (Length: 256)
Name: NF10189_low_19
Description: NF10189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10189_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 245
Target Start/End: Complemental strand, 40924380 - 40924143
Alignment:
| Q |
1 |
tatatgggacaatcttcttctaactctttttcattcagccttgaacattctcaatggcccctcagctctgccatcgtcattgcccattggtcaacgtaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
40924380 |
tatatgggacaatcttcttctaactctttttcattcagccttgaacattctcaatggcccctcagctctgccatggtcattg-------gtcaacgtaac |
40924288 |
T |
 |
| Q |
101 |
ctacaacaactgtgaaggatttgttagtttcttagatgaagattacaaagtatgataccaattctcattttccatactagattcacttcattcacaggcg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
40924287 |
ctacaacaactgtgaaggatttgttagtttcttagatgaagatcacaaagtatgataccaattctcattttccatactagattcgcttcattcactggcg |
40924188 |
T |
 |
| Q |
201 |
tttgtgttttatgcttcacttgttttcatccatttctatcttcat |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40924187 |
tttgtgttttatgcttcacttgttttcatccatttctatcttcat |
40924143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University