View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10189_low_24 (Length: 246)
Name: NF10189_low_24
Description: NF10189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10189_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 90; Significance: 1e-43; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 146 - 239
Target Start/End: Original strand, 6635033 - 6635126
Alignment:
| Q |
146 |
attaaattgtcacaggtatgaaacacacttgctgagtagctttgattttcaaattgttggtttttgaaaattatgatatctttgtacacctatg |
239 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
6635033 |
attaaattgtcacaggtatgaaacacacttgctgagtagctttgattttcaaattgttggtttttgaaaattatgatatctttgtacatctatg |
6635126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 82 - 185
Target Start/End: Original strand, 36893471 - 36893574
Alignment:
| Q |
82 |
cctgtcatgcagatttgtttagagatatgctttgagccaagtaccactccttgttgtcacaggtattaaattgtcacaggtatgaaacacacttgctgag |
181 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
36893471 |
cctgttatgcagatttgtttagagatatgctttgagccaagtaccaccccttgttgtcacagatattaaattgtcacgggtatgaaacacacttgctgag |
36893570 |
T |
 |
| Q |
182 |
tagc |
185 |
Q |
| |
|
|||| |
|
|
| T |
36893571 |
tagc |
36893574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 82 - 154
Target Start/End: Original strand, 6632200 - 6632272
Alignment:
| Q |
82 |
cctgtcatgcagatttgtttagagatatgctttgagccaagtaccactccttgttgtcacaggtattaaattg |
154 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6632200 |
cctgtcatgcagatttgtttagagatatgctttgagccaagtaccactccttgttgtcacaggtattaaattg |
6632272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 66; Significance: 3e-29; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 82 - 155
Target Start/End: Original strand, 32092071 - 32092144
Alignment:
| Q |
82 |
cctgtcatgcagatttgtttagagatatgctttgagccaagtaccactccttgttgtcacaggtattaaattgt |
155 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32092071 |
cctgttatgcagatttgtttagagatatgctttgagtcaagtaccactccttgttgtcacaggtattaaattgt |
32092144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 161 - 239
Target Start/End: Original strand, 32092250 - 32092328
Alignment:
| Q |
161 |
gtatgaaacacacttgctgagtagctttgattttcaaattgttggtttttgaaaattatgatatctttgtacacctatg |
239 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| ||||||| ||| |||| |
|
|
| T |
32092250 |
gtatgaaacacacttgctgagttgctttgattttcaaattgttagtttttgaaaattatgatttctttgtccacttatg |
32092328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 60; Significance: 1e-25; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 90 - 153
Target Start/End: Original strand, 13579873 - 13579936
Alignment:
| Q |
90 |
gcagatttgtttagagatatgctttgagccaagtaccactccttgttgtcacaggtattaaatt |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
13579873 |
gcagatttgtttagagatatgctttgagccaagtaccactccttgtggtcacaggtattaaatt |
13579936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 88 - 153
Target Start/End: Original strand, 13585413 - 13585478
Alignment:
| Q |
88 |
atgcagatttgtttagagatatgctttgagccaagtaccactccttgttgtcacaggtattaaatt |
153 |
Q |
| |
|
|||||||| ||||| ||| ||| ||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
13585413 |
atgcagatgtgttttgagttattctttgagccaagtaccactccttgtggtcacaggtatcaaatt |
13585478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 91 - 145
Target Start/End: Complemental strand, 35037616 - 35037562
Alignment:
| Q |
91 |
cagatttgtttagagatatgctttgagccaagtaccactccttgttgtcacaggt |
145 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||| | |||| |||| |||| |
|
|
| T |
35037616 |
cagatttgtttagagatattctttgagccatgtaccacccgttgtggtcataggt |
35037562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University