View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10189_low_29 (Length: 238)
Name: NF10189_low_29
Description: NF10189
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10189_low_29 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 210; Significance: 1e-115; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 210; E-Value: 1e-115
Query Start/End: Original strand, 14 - 238
Target Start/End: Complemental strand, 10592656 - 10592431
Alignment:
| Q |
14 |
caaaagtttccatttggccttacaatccacatatcccaattaacagcagaagaatagaaatgaacaatcctttacaacatggaaccttcatccaacaata |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10592656 |
caaaagtttccatttggccttacaatccacatatcccaattaacagcagaagaatagaaatgaacaatcctctacaacatggaaccttcatccaacaata |
10592557 |
T |
|
| Q |
114 |
tcataaataac-aaaatctaatctcaaatagcaccaacaaaataatcgtgaaaaatgaaactgattatttaatcatcaattgcaaaattttatttcaatt |
212 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10592556 |
tcataaataacaaaaatctaatctcaaatagcaccaacaaaataattgtgaaaaatgaaactgattatttaatcatcaattgcaaaattttatttcaatt |
10592457 |
T |
|
| Q |
213 |
cttgcaaatgttgtaattacattacc |
238 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
10592456 |
cttgcaaatgttgtaattacattacc |
10592431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University