View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1018_low_10 (Length: 204)
Name: NF1018_low_10
Description: NF1018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1018_low_10 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 71; Significance: 2e-32; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 71; E-Value: 2e-32
Query Start/End: Original strand, 1 - 75
Target Start/End: Original strand, 8711489 - 8711563
Alignment:
| Q |
1 |
gaaattgacaaagatatattcttctttttgtgggaaaaggtggagcaaataattgatatagtgggctaaggatga |
75 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
8711489 |
gaaattgacaaagatatattcttctttttgtgggaaaaggtggagcaaataattgatatagtgggcgaaggatga |
8711563 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 8735900 - 8735972
Alignment:
| Q |
1 |
gaaattgacaaagatatattcttctttttgtgggaaaaggtggagcaaataattgatatagtgggctaaggat |
73 |
Q |
| |
|
||||||||||||| | |||| | ||||||||||||||| ||||||||||||||||| || |||| | |||||| |
|
|
| T |
8735900 |
gaaattgacaaagttttattgtgctttttgtgggaaaaagtggagcaaataattgacatggtggcccaaggat |
8735972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University