View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1018_low_7 (Length: 295)
Name: NF1018_low_7
Description: NF1018
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1018_low_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 141; Significance: 6e-74; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 141; E-Value: 6e-74
Query Start/End: Original strand, 46 - 230
Target Start/End: Complemental strand, 45623107 - 45622936
Alignment:
| Q |
46 |
tgatgctttatacggtagtatatactatagtaaaaaataatattgacaaagctaatatacaaagctaattaattattatatattttactaccaacatgaa |
145 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
45623107 |
tgatgctttatacggtagtatatactatagtaaaaaataatattgacaaagctaat-------------taattattatatattttactaccaacatgaa |
45623021 |
T |
 |
| Q |
146 |
agagcaattatgacctggctgccaccgtcctttcgttgcttcacttcgacggccctttcaccagactctggtcgcatgatgatgt |
230 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45623020 |
agagcaattatgacctggctgccaccgtcctttcgttgcttcacttcgacggccctttcaccagactctggtcgcatgatgatgt |
45622936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University