View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10190_low_23 (Length: 263)
Name: NF10190_low_23
Description: NF10190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10190_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 104; Significance: 6e-52; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 153 - 260
Target Start/End: Original strand, 37214544 - 37214651
Alignment:
| Q |
153 |
aataaaaatgcctcctttatgtaatttttacattttataagggaaaatcatcatgaaatccacagaagctaactaaaacaagcatactagtgtttaatct |
252 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37214544 |
aataaaaatacctcctttatgtaatttttacattttataagggaaaatcatcatgaaatccacagaagctaactaaaacaagcatactagtgtttaatct |
37214643 |
T |
|
| Q |
253 |
aatttcat |
260 |
Q |
| |
|
|||||||| |
|
|
| T |
37214644 |
aatttcat |
37214651 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University