View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10190_low_27 (Length: 251)
Name: NF10190_low_27
Description: NF10190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10190_low_27 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 65; Significance: 1e-28; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 157 - 241
Target Start/End: Original strand, 28249495 - 28249579
Alignment:
| Q |
157 |
tagtttgatcattcgtctctactctctagaatcacttatattcaagaaaacgattcgttcaaacagccatcattcttgttctctg |
241 |
Q |
| |
|
||||||||||||||||||| |||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
28249495 |
tagtttgatcattcgtctcaactctccagactcacttatattcaagaaaacgattcgttcaaacagccatcactcttgttgtctg |
28249579 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 3 - 127
Target Start/End: Original strand, 28249307 - 28249431
Alignment:
| Q |
3 |
tagcaaatttcggagaaaaaattgcacagacattacacacattattat---atgacaggacnnnnnnntttgtttagtccaagcttggacgttgaattcc |
99 |
Q |
| |
|
||||||||||||| |||||||||| | ||||||||||||||||||||| |||| ||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
28249307 |
tagcaaatttcggggaaaaaattgtaaagacattacacacattattattatatgagaggacaaaaaa---tgtttagtctaagcttggacgttgaattcc |
28249403 |
T |
 |
| Q |
100 |
aatacttgacttggaagaaatttgacaa |
127 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
28249404 |
aatacttgacttggaagaaatttgacaa |
28249431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University