View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10190_low_28 (Length: 250)
Name: NF10190_low_28
Description: NF10190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10190_low_28 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 27 - 243
Target Start/End: Original strand, 49656461 - 49656677
Alignment:
| Q |
27 |
tgactatagatacaaaattttaaaatcacacttgcccaaaaaaggaacttagtatcacagttctgttattacagtgaagattagattggataactatgga |
126 |
Q |
| |
|
|||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49656461 |
tgactatatatacaaaattttaaaatcacaattgcccaaaaaaggaacttagtatcacagttctgttattacagtgaagattagattggataactatgga |
49656560 |
T |
|
| Q |
127 |
ctactatatgatttgacgcgatagagatctcgcgttatcataggtttaagagaagggtcagagtcagaggcattaaaagtcttatttgaatgagactcat |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49656561 |
ctactatatgatttgacgcgatagagatctcgcgttatcataggtttaagagaagggtcagagtcagaggcattaaaagtcttatttgaatgagactcat |
49656660 |
T |
|
| Q |
227 |
ttcattcattcatctca |
243 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
49656661 |
ttcattcattcatctca |
49656677 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University