View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10190_low_31 (Length: 249)
Name: NF10190_low_31
Description: NF10190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10190_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 4 - 231
Target Start/End: Complemental strand, 40591659 - 40591432
Alignment:
| Q |
4 |
atgatacatatagttagttaatctatgcatgacctttaaattatgtacggcatatatgtgtccaaaaaattaccacatgtggttgctttaaggtactcac |
103 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40591659 |
atgatacatatagttagttaatctatgcatgacctttaaattatgtacggcatatatgtgtccaaaaaattaccacatgtggttgctttaaggtactcac |
40591560 |
T |
 |
| Q |
104 |
cagataataataaggatgctgcatctgtggtagtgttgtgtcttttgtgtggagaagaaagaagagtctcaatcggcttttataggggcattactcccct |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||| |
|
|
| T |
40591559 |
cagataataataaggatgctgcatctgtggtagtgttgtgtcttttgtgtggagaagaaagaagaggctcaatcggcttttataggggcattaatcccct |
40591460 |
T |
 |
| Q |
204 |
ccaatattaattatgaaagacagtaaat |
231 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
40591459 |
ccaatattaattatgaaagacagtaaat |
40591432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University