View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10190_low_33 (Length: 247)
Name: NF10190_low_33
Description: NF10190
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10190_low_33 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 42 - 230
Target Start/End: Complemental strand, 27924252 - 27924063
Alignment:
| Q |
42 |
ttgtcctgccaatttcatatttatatttatctctcctagatggaatcatttatttctttacagaaataaaaatatagacttaacactaaaaatttctcaa |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || |||| |
|
|
| T |
27924252 |
ttgtcctgccaatttcatatttatatttatctctcctagatggaatcatttatttctttacagaaatgaaaatatagacttaacactaaaaaattttcaa |
27924153 |
T |
|
| Q |
142 |
aattaaatactcaatccaagcaaagccttaa-nnnnnnnnncaagcaagtttactatttaattaatttatcatcgcaagcacgtagatgc |
230 |
Q |
| |
|
|||||||||||||||| |||||||||||||| || ||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
27924152 |
aattaaatactcaatctaagcaaagccttaattttttttttcaggcaagtttactatccaattaatttatcatcgcaagcacgtagatgc |
27924063 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 71 - 111
Target Start/End: Complemental strand, 27923844 - 27923804
Alignment:
| Q |
71 |
tctctcctagatggaatcatttatttctttacagaaataaa |
111 |
Q |
| |
|
|||||| || ||||||||||| ||||||||||||||||||| |
|
|
| T |
27923844 |
tctctcataaatggaatcattcatttctttacagaaataaa |
27923804 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University