View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10191_low_18 (Length: 289)
Name: NF10191_low_18
Description: NF10191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10191_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 11 - 274
Target Start/End: Original strand, 17927381 - 17927644
Alignment:
| Q |
11 |
cagagaaattagctgctgaggatctgtttttcatacaattttatcataaaatttcataacaaccacaccaaataaacaaaattgagtggatctccatann |
110 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| || |
|
|
| T |
17927381 |
cagagaaattggttgctgaggatctgtttttcatacaattt-atcataaaatttcataacaaccgcaccaaataaacaaaattgagtggatctccctatt |
17927479 |
T |
|
| Q |
111 |
nnnnncttattaccgatctgcctcttaattaatccaataacttcaaacacaactatggtagcaaattccaaattgtatactcgatccaactcc-nnnnnn |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17927480 |
tttttcttattaccgatctgcctcttaattaatccaataacttcaaacacaactatggtagcaaattccaaattgtatactcgatccaactccttttttt |
17927579 |
T |
|
| Q |
210 |
naacgacaattttctcaatccaatgttgcaagtggtgtctatatattgcaatagtttcatatatc |
274 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17927580 |
taacgacaattttctcaatccaatgttgcaagtggtgtctatatattgcaatagtttcatatatc |
17927644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 116 - 202
Target Start/End: Complemental strand, 2484063 - 2483977
Alignment:
| Q |
116 |
cttattaccgatctgcctcttaattaatccaataacttcaaacacaactatggtagcaaattccaaattgtatactcgatccaactc |
202 |
Q |
| |
|
||||||||| | | |||||| ||||||||||||||||||||| ||| | ||||||||||||||||||||||||||| ||| ||||| |
|
|
| T |
2484063 |
cttattaccaaaccgcctctcaattaatccaataacttcaaatgcaattgtggtagcaaattccaaattgtatactcaatcaaactc |
2483977 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University