View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF10191_low_19 (Length: 284)

Name: NF10191_low_19
Description: NF10191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF10191_low_19
NF10191_low_19
[»] chr5 (1 HSPs)
chr5 (251-284)||(35588822-35588855)


Alignment Details
Target: chr5 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 251 - 284
Target Start/End: Original strand, 35588822 - 35588855
Alignment:
251 aaagaaagtatgcagagagcaaattgatagaagt 284  Q
    ||||||||||||||||||||||||||||||||||    
35588822 aaagaaagtatgcagagagcaaattgatagaagt 35588855  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University