View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10191_low_20 (Length: 270)
Name: NF10191_low_20
Description: NF10191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10191_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 16 - 259
Target Start/End: Original strand, 24825028 - 24825271
Alignment:
| Q |
16 |
gttcgaacggtcgcgtaaccgaattaactatcattggaaacaaaacatctccatcttcacatatcaacaaaccttttcaagcactttcaggagctttttc |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24825028 |
gttcgaacggtcgcgtaaccgaattaactatcattggaaacaaaacatctccatcttcacatatcaacaaaccttttcaagcactttcaggagctttttc |
24825127 |
T |
|
| Q |
116 |
aactgattcatttttcactgttttgacaaaactttcaaatttgaaggttttgtcattggtttcattaggtttatggggtccattacctgcaaaaatcaac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24825128 |
aactgattcatttttcactgttttgacaaaactttcaaatttgaaggttttgtcattggtttcattaggtttatggggtccattacctgcaaaaatcaac |
24825227 |
T |
|
| Q |
216 |
aggttttggtcactagaaattctcaacattagttcaaatttcat |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24825228 |
aggttttggtcactagaaattctcaacattagttcaaatttcat |
24825271 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 2e-21; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 119 - 203
Target Start/End: Complemental strand, 16216581 - 16216497
Alignment:
| Q |
119 |
tgattcatttttcactgttttgacaaaactttcaaatttgaaggttttgtcattggtttcattaggtttatggggtccattacct |
203 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||| | | ||||| ||||||||| ||||| |
|
|
| T |
16216581 |
tgattcttttttcactgttttgacaaaactttcaaacatgaaggttttgtcattggttttacttggtttgtggggtccactacct |
16216497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 119 - 203
Target Start/End: Complemental strand, 16963837 - 16963753
Alignment:
| Q |
119 |
tgattcatttttcactgttttgacaaaactttcaaatttgaaggttttgtcattggtttcattaggtttatggggtccattacct |
203 |
Q |
| |
|
|||||| ||||| |||||| ||||||| |||||||| ||||||||||||||||||||||| | ||||| ||||||||| ||||| |
|
|
| T |
16963837 |
tgattctttttttactgttgtgacaaagctttcaaagatgaaggttttgtcattggtttcacttggtttgtggggtccactacct |
16963753 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University