View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10191_low_25 (Length: 250)
Name: NF10191_low_25
Description: NF10191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10191_low_25 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 163; Significance: 4e-87; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 163; E-Value: 4e-87
Query Start/End: Original strand, 11 - 177
Target Start/End: Complemental strand, 24788477 - 24788311
Alignment:
| Q |
11 |
caaaggtgtgaaattctgtcacatgtcattactcattagagtgaagacttttcttaaaaaataatatatagatagattatagttcaactctacaacatct |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
24788477 |
caaaggtgtgaaattctgtcacatgtcattactcattagagtgaagacttttcttaaaaaataatatatagatagattatagttcaactctacagcatct |
24788378 |
T |
|
| Q |
111 |
attttcaaccttgaaatttataagatgatttttgtctgcctttaaataggatagcatgaatcaaccc |
177 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24788377 |
attttcaaccttgaaatttataagatgatttttgtctgcctttaaataggatagcatgaatcaaccc |
24788311 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 21 - 67
Target Start/End: Original strand, 30934277 - 30934323
Alignment:
| Q |
21 |
aaattctgtcacatgtcattactcattagagtgaagacttttcttaa |
67 |
Q |
| |
|
||||||||||||||| || ||||| |||||||||||||||||||||| |
|
|
| T |
30934277 |
aaattctgtcacatgccactactctttagagtgaagacttttcttaa |
30934323 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 11 - 65
Target Start/End: Original strand, 24300801 - 24300852
Alignment:
| Q |
11 |
caaaggtgtgaaattctgtcacatgtcattactcattagagtgaagacttttctt |
65 |
Q |
| |
|
|||||| |||||||| |||||||||| | |||||||||||||||||||||||| |
|
|
| T |
24300801 |
caaaggagtgaaattttgtcacatgtaa---ctcattagagtgaagacttttctt |
24300852 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University