View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10191_low_31 (Length: 236)
Name: NF10191_low_31
Description: NF10191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10191_low_31 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 236
Target Start/End: Complemental strand, 35842078 - 35841843
Alignment:
| Q |
1 |
tcacctacagaagaacttccataacaggacttgccattatcaagatctccacctctctgactgtctttacaatcggtagcaattgttgggtgcagaacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35842078 |
tcacctacagaagaacttccataacaggacttgccattatcaagatctccacctctctgactgtctttacaatcggtagcaattgttgggtgcagaacat |
35841979 |
T |
|
| Q |
101 |
ttgattcttctgaaggctttagatcttcatcatctgctgttgtttcctgatagggagacaaatccatcggagaaaagccaccagaagattcaggggtttc |
200 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35841978 |
ttgattcttctgaagcctttagatcttcatcatctgctgttgtttcctgatagggagacaaatccatcggagaaaagccaccagaagattcaggggtttc |
35841879 |
T |
|
| Q |
201 |
aagtgaactgttttcttttggcaaatgatctagcct |
236 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35841878 |
aagcgaactgttttcttttggcaaatgatctagcct |
35841843 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University