View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10191_low_33 (Length: 227)
Name: NF10191_low_33
Description: NF10191
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10191_low_33 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
| [»] scaffold0110 (3 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 1 - 227
Target Start/End: Complemental strand, 31639235 - 31639009
Alignment:
| Q |
1 |
aatgttatgagcaacaatgtaaggttcagtggacgattttcccttcttacatacaagatgaccaagaagggaacatcttcctggtgcttgaatgcctaaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31639235 |
aatgttatgagcaacaatgtaaggttcagtggacgattttcccttcttacatacaagatgaccaagaagggaacatcttcctggtgcttgaatgcctaaa |
31639136 |
T |
|
| Q |
101 |
tcataaccatggagggcaaagttgtgaggttcattgaaggtaatccagtgcttaactctgtctccaaaagctttgaagcatgtataggcataatgctcaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31639135 |
tcataaccatggagggcaaagttgtgaggttcattgaaggtaatccagtgcttaactctgtctccaaaagctttgaagcatgtataggcataatgctcaa |
31639036 |
T |
|
| Q |
201 |
aatcttttctgtgaatatgtagagata |
227 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
31639035 |
aatcttttctgtgaatatgtagagata |
31639009 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110 (Bit Score: 30; Significance: 0.00000008; HSPs: 3)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 177
Target Start/End: Complemental strand, 13140 - 13091
Alignment:
| Q |
128 |
ggttcattgaaggtaatccagtgcttaactctgtctccaaaagctttgaa |
177 |
Q |
| |
|
||||||||||| || ||||||| |||||||||||||||||| | |||||| |
|
|
| T |
13140 |
ggttcattgaaagtcatccagttcttaactctgtctccaaatgttttgaa |
13091 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 128 - 177
Target Start/End: Complemental strand, 20877 - 20828
Alignment:
| Q |
128 |
ggttcattgaaggtaatccagtgcttaactctgtctccaaaagctttgaa |
177 |
Q |
| |
|
||||||||||| || ||||||| |||||||||||||||||| | |||||| |
|
|
| T |
20877 |
ggttcattgaaagtcatccagttcttaactctgtctccaaatgttttgaa |
20828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 128 - 168
Target Start/End: Complemental strand, 29997 - 29957
Alignment:
| Q |
128 |
ggttcattgaaggtaatccagtgcttaactctgtctccaaa |
168 |
Q |
| |
|
|||||||||||||| ||||| | |||||||||||||||||| |
|
|
| T |
29997 |
ggttcattgaaggtcatccaattcttaactctgtctccaaa |
29957 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University