View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10192_3 (Length: 361)
Name: NF10192_3
Description: NF10192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10192_3 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 2e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 2e-65
Query Start/End: Original strand, 20 - 176
Target Start/End: Original strand, 1109017 - 1109169
Alignment:
| Q |
20 |
ctgtgaacgatggttcagacatatgaatgtgatctttgcagttcacaatgtgtctgaacagattgagatcaataatggcatggaaccccttcctgcagat |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1109017 |
ctgtgaacgatggttcagacatatgaatgtgatctttgcagttcacaatgtgtctgaacagattgagatcaataatggcatggaaccccttcctgcagat |
1109116 |
T |
 |
| Q |
120 |
gctacagatcatgtgcagagaaatacgtataaggatgtgaagaagaaagcatatatt |
176 |
Q |
| |
|
||||||||| || |||||||||| |||||| |||||||||||||||||||||||| |
|
|
| T |
1109117 |
gctacagat---gt-cagagaaatatgtataacgatgtgaagaagaaagcatatatt |
1109169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University