View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10192_high_1 (Length: 243)
Name: NF10192_high_1
Description: NF10192
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10192_high_1 |
 |  |
|
| [»] chr2 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 16 - 243
Target Start/End: Original strand, 41695949 - 41696176
Alignment:
| Q |
16 |
gaaaggttgatgccaactagtcaagtagttaagggtaaggctcaatcaaacatttcagaaccaaaagagtaaagctaaaagccaaggaacatggaaaaca |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41695949 |
gaaaggttgatgccaactagtcaagtagttaagggtaaggctcaatcaaacatttcagaaccaaaagagtaaagctaaaagccaaggaacatggaaaaca |
41696048 |
T |
 |
| Q |
116 |
acctttatctttcagcaactactaggtccatgattaattaagcaagtaggtgttnnnnnnncatagacagagaggatggacaaaatcatgaaacgcatgg |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41696049 |
acctttatctttcagcaactactaggtccatgattaattaagcaagtaggtgttaaaaaaacatagacagagaggatggacaaaatcatgaaacgcatgg |
41696148 |
T |
 |
| Q |
216 |
tttatggagtgtcaatgtgtcatcatgc |
243 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
41696149 |
tttatggagtgtcaatgtgtcatcatgc |
41696176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University