View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10193_low_9 (Length: 288)
Name: NF10193_low_9
Description: NF10193
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10193_low_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 247; Significance: 1e-137; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 271
Target Start/End: Original strand, 27203010 - 27203280
Alignment:
| Q |
1 |
acatcatcgtcttatatgtttaatgatgtgtttaaggttaatttggcactgctgtgttttaagaatgctgaaattattttggaccttttggtgtgttgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27203010 |
acatcatcgtcttatatgtttaatgatgtgtttaaggttaatttggcactgctgtgttttaagaatgctgaaattattttggcccttttggtgtgttgtt |
27203109 |
T |
|
| Q |
101 |
tacagttcagggtaatgatggtccctcagttgatgctgcttttaagagcgatttggttaacatgagaacttttcacatggaatatgattcatgcagtgtg |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||| ||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
27203110 |
tacagttcagggtaatgatggtccctcggttgatgctgctgttaagggcgatttggttaacatgaggacttttcacatggaatatgattcatgcagtgtg |
27203209 |
T |
|
| Q |
201 |
agttcgtataaaatttatcaattttgctattaatttttgcttttggtcactgttctagagtaccaagtgat |
271 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27203210 |
agttcgtataaaatttatcaattttcctattaatttttgcttttggtcactgttctagagtaccaagtgat |
27203280 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 150 - 204
Target Start/End: Original strand, 16421718 - 16421772
Alignment:
| Q |
150 |
gatttggttaacatgagaacttttcacatggaatatgattcatgcagtgtgagtt |
204 |
Q |
| |
|
|||||||||||| |||| || ||||||||||||| |||| ||||||||||||||| |
|
|
| T |
16421718 |
gatttggttaacttgaggacgtttcacatggaatttgatgcatgcagtgtgagtt |
16421772 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University