View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF10194_low_20 (Length: 249)
Name: NF10194_low_20
Description: NF10194
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF10194_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 7 - 237
Target Start/End: Complemental strand, 14347516 - 14347286
Alignment:
| Q |
7 |
tttgttccttaaagtctcaatgctaacatccttttgaataattgcatgcccaagatgatgaaccatggcaatagacctcagattgtgagaagttagtgct |
106 |
Q |
| |
|
||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14347516 |
tttgttctttaaagtgtcaatgctaacatccttttgaataattgcatgcccaagatgatgaaccatggcaatagacctcagattgtgagaagttagtgct |
14347417 |
T |
|
| Q |
107 |
ttgcaaacaccaatatccccagctctagcaaattttgcttcgtcagttggacgcattatatgctcatctacgatgttagatcgatcgatggacaaattcc |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14347416 |
ttgcaaacaccaatatccccagctctagcaaattttgcttcgtcagttggacgcattatatgctcatctatgatgttagatcgatcgatggacaaattcc |
14347317 |
T |
|
| Q |
207 |
ataatgagtcctcacctttgtcaaactccct |
237 |
Q |
| |
|
| ||||||||||||||||||||||||||||| |
|
|
| T |
14347316 |
acaatgagtcctcacctttgtcaaactccct |
14347286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University